EST 1805740 is a singleton


Sequence

>1805740 (1 EST) Length=403 TCACTGACATTGTGCGACAGTGCCTGGAAGCCCTCTCGTATCTCCATCAGTGCTACATTATTCACCGTGATGTCAAGGCG GCTAACGTATACATGACCAAAAACGGCAGCGTAAAAATTGGGGACTTTGGTGCAAGCAAACTTGTAAACTTGACGGATCC GTTGGCAAACACATTTATTGGTACGCCTTTTTACCTTTGCCCCGAACTCTGCCTTGGTGAGCCATACTCGTTTGGTGCTG ACGTGTGGGCATTGGGTGTCCTCACTTATGAGATGTACTGTCTGAAACTTCCTTTTGTTGCAGATAACGTGCTGGCGCAA ATTCACGTCGTCACAGAAGGGCAGTACGATAGGGAGGCACTTTATCGTGCGCACACTTTCAGTCCATCTGACCTGCAGTC ATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805740: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057403366397AI066232TENU2347T. cruzi epimastigote normalized cDNA Library


Date: 12:1:7 on Thu 23 Nov 117.