EST 1805749 is a singleton


Sequence

>1805749 (1 EST) Length=307 GTCGCTCGCACGTGCTCTTCACGGTTTACGTAGAAGTTTCAGAGGGGGATGGACCCACTCGTCATGGCAAAATCACTTTT GTGGACCTTGCTGGGTCGGAACGTCTGCGGGACACAGGCAGCCAAGGTGATGACAGCAAATCCATTAATCGCTCTCTTTT TGTTCTTGGGAACGTTATTGAAAAACTTTCCAAATGCCACCCACTAGGTCGGAAAGATCATATTCCTTATCGCTCGAGCG TGTTGACGCAGTTGCTGATGGATACTCTTGAGGGTGGCTGTCGGACTCTCCTAGTGGCATGTGTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805749: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057493366406AI066241TENU2357T. cruzi epimastigote normalized cDNA Library


Date: 4:30:39 on Thu 23 Nov 117.