EST 1805754 is a singleton


Sequence

>1805754 (1 EST) Length=333 CGCGTGAGTGTGTCGTGTGGCACCGTGTGAGACGTGAGACCAATATATCTTACGGCAAAATAAAACGCAAAACGAGGGTG CAGGACTGCGTTGCTGCTGACGACACTGCGAAAACCGCGCTCTCCATCGCAGGTGTCGTCCGATGGGGTTGGCGCGCACA CCCGATAGAGCCAAGCGGCATCCTGCGTTTTTCTGGTTACGGGCAACTTTACTCCTTTCTGATTCTAATTGAAAACGGCT ATATATATATATTGGGAAATTGTGAAAAGGGTGTTTGCGAGGGGGCTGGTTAACTCAATGAATATCTTGTGATAAAACAA ATACATTTCTGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1805754: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057543366411AI066246TENU2362T. cruzi epimastigote normalized cDNA Library


Date: 11:38:46 on Wed 22 Nov 117.