EST 1805763 is a singleton


Sequence

>1805763 (1 EST) Length=322 GCTTGTGGTTCATAATATACACCACCATCGTTGACGGACAAACTTCTAAAGCCCCTGCAGGATGTGAAGGGGATTTCAAC CCGTTCATTTATTAATCTTCCTTTGGGGAAATAAGCGATTGAGGCTTGTGCTGTAGAAGAGTCATATATACATATATACA TAAACATATGCATCTTTTTTTCTGTCAAGGAAGCCATCATGGAAGGAAACAAATGAATGGCCTTTTTGCTCTGCCGGCAC GCCGTCTGAAGGCACGAGGGGTTTACCTGCAACGTCGTAGAATTAATGCTGGCGTGAAGTCACAGTACGGAGGCATGTTC AA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1805763: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057633366420AI066255TENU2371T. cruzi epimastigote normalized cDNA Library


Date: 19:53:5 on Sat 18 Nov 117.