EST 1805765 is a singleton


Sequence

>1805765 (1 EST) Length=347 CCCGCCCCCCACAACCATGGCAGAGCCCAAACGCACCCCACGGCTGTTGCCTCTTGGGACCGGCACCCGGCTCCGACGGA ATAAGCTGGAAAGGAGCCGCGACATCTAGGCCGTGCGGCGCGGCGTGCCGTCTTCCGGCTGCTCAATAGACGCCTGCGTA CAGAAGCCGTCCGGCGGGATTGGCGACGCGTGGTTGTCGCCATCCCCTTCCCCAAGCCAAAGAAAACGGCATCCGACCGC GACCCCACCGGCCCGTCACGCTGACCAGCTGCCCCGGCAAGCTCATGGCACGCATCCGAGACGCCACCGAGTCCCAGTTG GCCCTGCTGCGATCTTGTTGTTGGCCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805765: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057653366422AI066257TENU2373T. cruzi epimastigote normalized cDNA Library


Date: 2:16:36 on Wed 22 Nov 117.