EST 1805766 is a singleton


Sequence

>1805766 (1 EST) Length=223 TTGTCTGTGACTTCCACTTGAACACGGATCAGGTGATTCTCTATTGCTTTTGTCTTTGCTTTTGTCCTTCCTTTTCCTTT CAACATGAAGGCCCGTCACTCAATAGTCGGTTTTAAATATTCATTTGATTCTCCGCAGCTCCCTACCACGTAGGTGTGTT CTTCGTGCCCTTCTTGCATATGAGGCGACTTGTCACGCAGTGCCCCCACGCGCCTCGCTGCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, Processing,


Cluster Information for 1805766: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057663366423AI066258TENU2374T. cruzi epimastigote normalized cDNA Library


Date: 17:15:37 on Thu 23 Nov 117.