EST 1805770 is a singleton


Sequence

>1805770 (1 EST) Length=385 GAGTGAGTTTTCTGTTGTTTTATTTTCTCAGACTTCACAAAACATCGACATAACAAAGCACCATGGGCTTCGAAACGCTT GCCGGGAGGGTTGGACCTTTTGCATACATGGTGTGCGCCTGCATCTCATTTGTGTTTGCAACTGTGTCGACGCCAACGTC GCAGTTTAAAGGAAAGGGGTACTTGGATGGAGGAAAAGTGTCGAAGCTGTCCTGCGTAACGGCCTGGGGAGTTAAGAATG AATGCACCAGCGATAAATACGATCTGCGCTCTTCAGAGATCAACTGTGACGGTAACGATAAAAGTTTACATCAGTTATTT CAGACTACCCAAGCCTTTTCCATCATTTCCATTTTTTTAACATTTGCGTCTATCATTACTGTTGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805770: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057703366427AI066262TENU2378T. cruzi epimastigote normalized cDNA Library


Date: 3:6:23 on Tue 21 Nov 117.