EST 1805771 is a singleton


Sequence

>1805771 (1 EST) Length=486 TGAGTTGTACATTGTGCTTGGCTGAGAATGCGATTGGACCCGATGCGTACCGCAATGATGACATTTTGACATTGAAGTCG GGGAAGACTGTGGAAGTGAATAACACCGACGCTGAGGGTCGCCTTGTACTCGGGGACGGAGTTTTTCACGCAACACATGA GATTTCCTTTAAGCCGGATGTTCTTGTCGACATGGCTACTTTAACGGGTGCGCAGGGCATTGCCACCGGCCACAGGCACG CGGGCATATTTGTAAACGATGAAGAAGAAGAATTTTCCTTCTTGAAGGCCGGCAGGGTCTCCGGCGAGACGTGCTTCCCC GTGCTGTACTGTCCGGAGTATCATGTAACAGAGTTCAGGAGCCCCGTTGCTGATATGCGCAATTCAGTGAAGCAGGTAAA CAACGCCAGTGTCTCGTGCGCAGGACACTTTGTCGCTAATCACCTCAGCCCTGACTTCAAAGGCAAGCACATCCACGTGG ATATGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805771: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057713366428AI066263TENU2379T. cruzi epimastigote normalized cDNA Library


Date: 6:13:35 on Wed 22 Nov 117.