EST 1805773 is a singleton


Sequence

>1805773 (1 EST) Length=487 AATGAAATTCGTCGGGCTTCTGGTGAATATCAAATTTACAGAAATATTCCTTCCAATGTAATGCATCCACAAAAAAACGC TGATGTTTTTACAGTGTCAGACAATTGGAATCATCCTCGTAGTGAATGGAGTATGAAAATGCCAATGCAACCAGGTGCTG GAACTGTGCATTCATGTGCTCGAGCAGACCCAAACAGTGGCGCTACACGTTTCCAGTCACAAAATGTGGGAACTTCTACT GTTCCACAGCAGCTACAAAACTGTTCCATTATACCGCCGTCGGATTCGTTTTGTGGGCCAATGGATCCCATGGTTTCAAA CGTTGAAAAAGAAGATAATAACGTACCATTGGACTCTGGATATCAGCCTTCTGAGAGTTTTTATGATTTGTTGTTTTTGC AAGACGATAACCGGAGCGAAAGTCCTATACCTTGCCATAATAACATGGATGTTTTTTCCGGATACGATCTTTTCTGCGGT ATTAGGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1805773: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057733366430AI066265TENU2381T. cruzi epimastigote normalized cDNA Library


Date: 15:10:3 on Wed 22 Nov 117.