EST 1805781 is a singleton


Sequence

>1805781 (1 EST) Length=372 GGCCGTGAGTGACATGGGAGGCCTTCAGTCTACTGGTGACGCGGAACTTGACCGCTGGAAGGCGCCTCTTGACGCCATGT TTCCAGCAAAACAATCAGAAGATCGGATGCAGAACGACTCGTTTTTGAAGCGTCTGTATGATACCGGCGAAAACGGGTTC GGAGAGCCAACCGTAGACGCCGTGCGCAACAGAAGGAGGACGAACTGGAGCAGTACAGGAAGAGCGCATTTAAGCGGGAA AAGAGCACCAAAGACGATAGAAGCAAATCGAAGGAAAAGAAGGAGAAGGAATGACACCTCCACATCGAGTGGGGCCGTGC GCATGTGTTTGTATATATGTGTATATATTTTTTGGGCGAGAAAAAAAAGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805781: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057813366438AI066273TENU2389T. cruzi epimastigote normalized cDNA Library


Date: 11:41:30 on Wed 22 Nov 117.