EST 1805790 is a singleton


Sequence

>1805790 (1 EST) Length=341 ACGGTGCGGGTGAATAACAACCGCGACACGGAGCAGAGTGGAAACAACAGTGTAGAAAGGGAAGATTTATTTGCTTCTTT TGATGCTCGCCGGCATGAGGGAGCGGGTGCCGTAACGTACCTGTCAGAGCACCGAACCGTCTATGTTGGGCGAAGGAGTG AGGGCAACAGGTTTATTTGTGACGACATGCTTTAAAAATGGGGCACACACACACACACGCACGCAAATGTGTATAAGGTA CACAACCTTTCCCCTTCCCTTCCCAACCCCAACCCCATCCCCCGTAGGTGTGTTTGTGCGTGAGTGTATGTTTGTTTGCT TCATTGTGAATTAGGAACAGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1805790: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18057903366447AI066282TENU2398T. cruzi epimastigote normalized cDNA Library


Date: 14:9:29 on Fri 17 Nov 117.