EST 1805806 is a singleton


Sequence

>1805806 (1 EST) Length=623 TGTCCGATGTTAAAGGGGAGAATACGCTTTACGGGTGTCGGAGCCTTGCACGACCACGCGAACGTGAGACGGCGGAAGTA GACATTGGTGCGTTGCGGCCCTCGGATGATCCGTGGGGCACAAATGTTGATCTGCAACCTGGTGTCTTTGTCTCTGCTGC AGAGCAAAATGTGGAAAAACGGATCGAGCTTATTGAAACTCTGAGTGCGCTCTATCGCCGTCCATGGCAAACACTGCAGT CACGCGGAATACAAACGGAAAAGTTTACACCGGGCTCAATAAATGAGACAGCGCCTCATGTGGACCCAATAAAGTTGCCC GCTGCCATGTTAGATCCTGAGGAGGATCTTGGATGGAAGCAATCAGCAGTAGAGGATGCCTCAAATAACCGCTGGGAATT GCGAGTGACTTCTTCCAGTACCGCAACCTCGGAACTGATCCCGGTGCGAGGACGCTTCATGCACTTTGGACGAAGCGCTG GTGTGACCAGTGCCGCACATGGCACTGTGACAAACGTTCATGTTGGGCTCTCTGCCTTTACCAACCACCCCGAGTTTCTC TCACCGCATCATTTTTCTCTTGCGGTGCTTTCAGCGAACGTCCATGGAGTGCCAGTGATGCAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1805806: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058063366463AI066298TENU2414T. cruzi epimastigote normalized cDNA Library


Date: 7:43:11 on Sat 18 Nov 117.