EST 1805809 is a singleton


Sequence

>1805809 (1 EST) Length=580 CTGATGGTAAGCTTTATTTGATTTTTGAGTATGTGGATTACGATCTCAAAAAGGCAATTGAAAAGAGGGGCTGTACTTTT ACAGGTGTGACATTAAAGAAACTTGTTTATCAGCTTCTTGATGGTCTATTTTTTTGCCACAGACATCGAATTGTGCATCG TGACCTCAAACCTGCAAATATTCTTATTACGAGTGATAATGTTCTTAAGCTCGCCGATTTTGGTTTGGCGCGCACATTTC AAATTCCCATGCATACTTATACCCATGAAGTTGTCACGTTATGGTATCGAGCCCCAGAGATCTTATTGGGAGAAAAACAC TATACCCCTGCCGTGGATATTTGGAGTGTTGGATGTATTTTTGCAGAATTGGCTCGAGGTAAGGTTATTTTTCGCGGAGA CAGTGAAATTGGCCAGCTTTTTGAGATATTTCAAATTCTTGGGACGCCAATGGACAATGAGGGATCATGGCCTGGAGTAT CTTCTCTTCCTGACTACCGCGATGTGTTTCCCCGTTGGGCAGGAAAACCACTTGCTCAGGTGATTCCGCAGCTCGACAGT GAGGCAATTGATCTTATTTC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805809: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058093366466AI066301TENU2417T. cruzi epimastigote normalized cDNA Library


Date: 15:12:47 on Wed 22 Nov 117.