EST 1805817 is a singleton


Sequence

>1805817 (1 EST) Length=584 TCTCTCCCACCCCGAATCGTGCGTTTCTTCCGAGCCCAATTTGTCAACTTTTTTTTCCACAACGATGAAATTGACGACGT CGCCGAATAACAGAACGCGGGATGTTATCAGCATTTCGCACGGCGCCAGCCTATGCCATCTGCAAAGAGGTTGTGGCAGG ATCCGGTGGTCCCCTCGAACGATCAGGAGGCCAATGCGTTCATTATGTGCCATTTTTCTCAACAGCCGTCAGCAAAGGAA CAGTTGGATCAGACGAGGAGGTCTGTCTCTTTGGAATCCTCTTCTCCGAGCGTCTTATTGCCGTCGCTTGCAATGACATT TGAGGGAGAAGTGTTGCGTGGGTACAGACAGCAACTTGTGGATGGTATACGTACCCGAACCGTGTGGCATGACTGTGCCC TGTACGTCTTGGCGCCTGAAAACAGCGAGGGAAAAGGCCCCAATACGGCCGGTGCTTCACAACTGGGGGCCGCCGCAGTC GTGTTTCTCGCAGCGGAGCATAAGCTTGCGCTTTCGCCGTTTCGACGTATGCGACGTATATTTTGCCCAGATGAGTTTAC TTTTGCGGCGGCGTGTGTGTACGC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1805817: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058173366474AI066309TENU2425T. cruzi epimastigote normalized cDNA Library


Date: 13:30:44 on Wed 22 Nov 117.