EST 1805819 is a singleton


Sequence

>1805819 (1 EST) Length=373 CAAGGAATCATTAGTTGCGCCGTGCCATCTGTGCAGCCCGATTGGATGAACCACGGACACACGATTTTGTTTCTGTTTGC TGCTTTCATCTTCTTTTACTTCCATATCTCTCTGCGTGCTATTATAAGCGCCATTGCAGTTGAAGCAGGCGGCGGCACAC ACAACATCATTTCCCAACACATTTGGTGGCGAACATAAATACCCCTCGCCTGGGAGATGTGGGTGCCCACAAGAAGCGCA CGACACAGTGATGCCGTGAAACCCTCTGGTGACGGTCCACCCATGCAGGCACCACCGCAGCAACGCCCACACATGCGTCG TCGGCAAGGGGGAGAAGGAAAGTGGAAGTGGATGGCGTGCGGGCGATCGTGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1805819: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058193366476AI066311TENU2427T. cruzi epimastigote normalized cDNA Library


Date: 6:53:41 on Mon 20 Nov 117.