EST 1805821 is a singleton


Sequence

>1805821 (1 EST) Length=496 GCATGTGCTTACGTCAGGGGCAAATATATATTTTTTTTTCTTGTGCCTTTCTGGGTGATGCTTGCGACGCTGAAAATGTA CCCCTCGTTGTTATTGTTTTTGTTGGTTTGAGTAGTGATGGTTGATTCAAGGAGGAATGGTGTAGCTCTGCAGTTACTCG GCAAATTTATACATGTCTCATCCCCTTTTTTATTTATTTTTATTTTATTTTTACCTTGACGCATCGTTTGGCGCAAAAGG GCATTGTTTGAGGACTCACACAACACTCACCTTCCCACAGTTGGGGGACGGGTGGGCGACGTCCTGAGCACATCCACCTT TTTTCCTTTCGTACGTGGTGCTCATTGGATGACGAGTTGCCATGTTGGACTTTCTCCTAGTCTCTGCTGCAGTATATATA TATATACAAATGACCATCAGGTAAATTCAACTAAAATGAATTTTTTCTCTCCCTCTTCCCTCTTCCTACCTCTTTTTGGG GGTTTGGAGGGAGGAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1805821: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058213366478AI066313TENU2429T. cruzi epimastigote normalized cDNA Library


Date: 11:1:17 on Tue 21 Nov 117.