EST 1805828 is a singleton


Sequence

>1805828 (1 EST) Length=393 CAGGACATTTTACTCCGTTGAGTAGTGAACTGACGGCGGCACGAGATAACTCCCCCGCCCCGTCCCCTTCCCTGATGTTG TCCATCACCCGTCGCCGCGCGGATTTTGGGAAGGAGTTGTACGGCAAATTATCGACGCTCCCGGGAGATTTTTATGAGGC CTGTCGTAGTCACTTTGGAATTACCCTGCACCAAGACACATTCATTGGAGTCCGTTCGTCACAGGTACGAGGTTTGTTTT TGTCTACCAGCAGTACACCGCTGGAGGCCAATAAACCAATTGCCACTATTCCGCTGACAAGTCTCTACACGGTTTCTAAC ATTCAAAGTAAACCCAACACACTTCGTCACGTGACATTAGATGGTGTGCGTAATGCCGTGCGAGAGGAGGAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1805828: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058283366485AI066320TENU2436T. cruzi epimastigote normalized cDNA Library


Date: 11:30:53 on Fri 24 Nov 117.