EST 1805830 is a singleton


Sequence

>1805830 (1 EST) Length=540 TGCTGTTACTGTGACCGCTACTCGTTGCCGGTGGATTTCACCATCAATTCCCCTGTCACCCACCTCACTAGACATCGTGA GGGGCTGTGGACATAGAGGGGCTGGCAAGAAGGAAGAGAGAGAGGGGAAAAAAAAGAGAGAGAGAGAAAAAAAATGGTGG GGGATGTGAACAACGTAGAAGTGAAGGAAAAAAAAAGGGATATGAGGTAAAGAAGGTCCCTGTGTCTCCTGTAAAACCAT CCCGACCAACCGCCTACGTCAGGAAACCCGCATCGGCACGTAACGTGGGGAGCCCGTCGGCGAAACATGATGCGCTGGCA TCTTTCACCTCGCCGAGGGATTCAAAGCGTCACGTACCGGACTGTGGCTTCGCGTCACCGCACAGCAGCAGAAGACCCTA CAGGAGCGATCCGAAGCATTTTGAGCTTCATGTCCGTTCTTCAGTGGAAAAATCGAGGGCTTTAGAGACGCCGGAGTAGC GAAGGTCTCTGCGTCAGGAAATGGCACCGATGGTCCATTGTTTTCCAGCGACGCTGAGAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805830: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058303366487AI066322TENU2438T. cruzi epimastigote normalized cDNA Library


Date: 10:44:44 on Sat 18 Nov 117.