EST 1805832 is a singleton


Sequence

>1805832 (1 EST) Length=483 CACAGATGCGTGCGCGCTATATGCCATGAGACTTATCAAACAGCACCTTTCTAATGCGGTGAAGGATGGCAAGAATCTTG TGGCACGAGAGGGTATGTGCTACGCGCACATCTTGCTGGAATGGCATTTAACAGTGCAGGTCTCGGTTACGTGCACGCAA TGGCTCATCAGCTTGGTGGCTTCTACGACCTCCCCCATGGCGTCTGTAACGCCATCCTGCTGCCACACGTGGAAAATTAC AACTCTTTCGTATGTGCGCGCCGTTTGGGTGATGTTGCCGTGCAATTGGGTGTCAGTACGACAGGCATGGACGATAAGAA TGCCGCTGCTGCTGCAATTGATGCGATTCGTGCTTTATCAAAGGAAGTTCAAATCCCACCAGGATTTGAACAACTTGGTA TGAAGGAGAAGGACATTCCCGCGCTGGCAGAATCAGCCTTGAAGGATGTTTGCGCCGCCACTAACCCGCGACAGGGCAGC AAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805832: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058323366489AI066324TENU2440T. cruzi epimastigote normalized cDNA Library


Date: 13:19:46 on Wed 22 Nov 117.