EST 1805841 is a singleton


Sequence

>1805841 (1 EST) Length=541 ACAGGTGACGGTCGCAAGAGCCAAGAAGGAGGTGGCGAGCCGGGGATTAGTTCCTGGGACACACAGATGGAAAGGCTGGC TTATGATATCCGCATTTTTATTATTAATGGAAACGCTATACGGTCTGCAAAGGCGCTACCGCGATGCGAATGAACGGCGA GCAACTCATCGTCAGAAACGTGGAATGCATACCACCAGTGATGAAGAAGGCTTAGAGAACAGAATTTCGCAGAGTGGGGA GTTAAGTAGTGACGCTGTGTCTTCCGAATTTTCCACGGATTACACGGCATCTTTTTTGGATTGTATGGGCGATAAGAGCG GTAAGGGCGGGCGTCTTTTTGTTGCTGTTTTTGACTACGAGTCACCGGATCGGGAAGGCTTTATTGGATTTAAGGCAGGG GACCGTTTTTTAATTGAAGAATATGCAGAGAATGGATGGTGTGAAGCAATTCATATGGACACAGCTGAACGGCCAGTACA AAAAGGGCTTGTCCCTGGCAACTTCTTGCGCCCACTGGAGGGAGAAACAAAGCTGTAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805841: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058413366498AI066333TENU2449T. cruzi epimastigote normalized cDNA Library


Date: 7:40:28 on Sat 18 Nov 117.