EST 1805844 is a singleton


Sequence

>1805844 (1 EST) Length=470 ATTCCACGTCGCGGCAGGATCTTTTGCAACGGCTTTTGATTTGCTGCGACGCCAAATTGGTTTGTGTGACCCTGAACCAC TGAAACCGTACATGATGAACCTGTGGACCTCCGCAAACGCCTCACGACCGTCATGGATTGTTACATCCGTTGTGTTCCCC TTGACCAAATATCCGTCTGGGGAACAACGGGGTGCCCATCACGCTCCTTTGCTTCCGGAATACATTCCGGTGTTGACAGA GAAGCTTCGGGCCGGATACACGGCATTTGTAGAGGGACGCTTTGCGGATGCCCAAGCTCACTTTGTTGGGATCATGCATC AAGCAGTTTTTGCCACGTACGAGGACGAAAAGCAGCGCGCAGTCCCTTCTTGAGCTTATTACAATTGCTTCTGAATATGC GCGCGCTCTCAGCGTACAACTTCACTGTCGCAGTATTGACGGAAACTCTAAGGAGGCACTGGAGCTCTCT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805844: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058443366501AI066336TENU2452T. cruzi epimastigote normalized cDNA Library


Date: 4:5:25 on Thu 23 Nov 117.