EST 1805845 is a singleton


Sequence

>1805845 (1 EST) Length=486 TGAAGGAAAAAACAAAAGCAAAAAGAAGGAGGGCGTTGAACCACACGGAGGCGGAGAGAAGGAAAGGGATTCAAAATGGC TGCGCTTGTGGAGGCGGACGGATGGAGAGGGAGAAGGCGCTGGTCGAGGCACAGCAGCGGGTGAATATGTTGAGGGAGAC GGTGAGAGTCATGGCAAACCGGCAGTAACGCTGATGAGCAACAAACGACGACTTGACATCTCCACGAATGAGTTGACACG TCTCGCCGCAGATCACCGCGTGTACGAAAGCGTCGGCCGTGTGTTTTTGCGCACGCCGGTGAACGCATTGATAGAGAAGC AGACGGCGCAGGCTGAGAGCTGCGAGGCGGAGGGAACACGTCTCTCGAACGAGAAAAAACGCGTGACGGAGCAGCTGAAG AAGGAGGAAGCGCACTGCCGAGGCTGCCGAGACGTACGTGGCTGAGATGAACGCAAGACAACGCCAACGCCAGTAGGAGC AGTCTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805845: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058453366502AI066337TENU2453T. cruzi epimastigote normalized cDNA Library


Date: 1:44:34 on Sun 19 Nov 117.