EST 1805850 is a singleton


Sequence

>1805850 (1 EST) Length=323 CTGCTGTTGGTGTTGACAGAGTTGATGGACTATTCCCTCAGCGACGTGATGCACCGTCATTGCAGCCGCGGTCATCTGAC GGCATGCGAAGCGAGGGCCATAGCTTTCCTTACATTGCATGCCCTGGTAGACCTTAATGACAGGATTGGCATGGTGCACG GCGACTTAATTCCCTCCAACATTTTGTTGCGTGGTACGGGAGAACTGAAGCTTGGTGATTTATCCAGTGCGATGCCCGTG AATGCGGCGGCTGGACTGCTTTAGCGGCACGGTGCTTTATACCGCCGTTCAGGTGTTAAGGGACCGGCAGTGGACTTCCA GCC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805850: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058503366507AI066342TENU2458T. cruzi epimastigote normalized cDNA Library


Date: 22:40:57 on Thu 23 Nov 117.