EST 1805855 is a singleton


Sequence

>1805855 (1 EST) Length=500 GAAGTTTGTTGACACATGGAAAGCATTGGAGAAGCTCTACGAGGAGAAGAAGGTGCGGGCCATTGGCGTTTCCAACTTTG AGCCACACCACCTCACGGAGCTTTTTAAAAGCTGCAAAATTCGGCCGATGGTCAACCAAGTGGAGCTGCACCCGCTGTTC CAACAGCGTACTTTGCGGGAGTTCTGCAAGCAACACAACATTGCCATCACAGCCTGGTCTCCGCTTGGCAGCGGGGACCG GACGGGTTTTCTGAAGAATCACGTGCTGGGGGAGATTGCCAAGAAGCACAATAAATCCCCGGCGCAGGTTGTCATCCGCT GGGACATTCAGCACGGTATCGTGACAATTCCCAAGTCCACAAATAAGGGGCGCATTCAAGAAAACTTTAATGTTTGGGAC TTTAAACTTACGGAAGAGGAGATGCGTCAAATCGATGAACTCAACGAGGATAAACGCATCGGCGGACACCCTGATAATTT TTTCCCTGGTGGAGAGGAGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1805855: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058553366512AI066347TENU2463T. cruzi epimastigote normalized cDNA Library


Date: 23:48:6 on Fri 17 Nov 117.