EST 1805863 is a singleton


Sequence

>1805863 (1 EST) Length=597 TCACATCCTCGAGAGCAATCAGAAGGCCCGCAGCAGTCCAAGTAATGTCTGGATTGAGGACTGGGAGGTGGAGAATCATG GATTGCAGCCTGAGCCCGGTGCTGTCCCTACGCAGTTGCTGCTGGACAAGCCACTGGAGCTTTTTAATTTCGACCAACTC CTCTCCCCACCGGAGTATGGAGGCGCCAAGACACAGCAGCTACAGCTCGCGAAAGATGTACGGTGAGAAGCTGCAGTTTG AGCTCAATGACCGTGCGCAGAAGCACGCTTCCAGAGCAAATGGTGGCTCACGAGGGCGCAGGCGATTAAGAACTCCCTTA CTTTTAAGGGAGGCGCGCGTAGTTCCATCATCCTTACAAAAAGTTCGCTTAAACTGTTTCACTCCAGCCAACTGATTGGT GGAGAGGCTCTGATGACACACCCAGTCTCTGGCGGATCGAGGAAGTTGTACAGCAAGAAGGGCGAACGTTTTCAAATTCT TTCGGATTATATCCGTCAGAATAAGTTCAACAGTGGTCTTTACTTTACAAATCGCCAGCTGGAATTTTTTAAGCTTGCCG TGCAGCCAAGCCAGACACCGGTGTCACTAGACGTCAC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1805863: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058633366520AI066355TENU2471T. cruzi epimastigote normalized cDNA Library


Date: 22:19:26 on Sat 18 Nov 117.