EST 1805866 is a singleton


Sequence

>1805866 (1 EST) Length=432 TGGATGACGTTCTTTACCGCAAGCACAAGTTTACCCGGAAGAAGGCGGAAGAAATTGCAGACTTCCTTCTCCCAATGCTC GAGTTTGATCCTCAAAAAAGAGCGACTGCTACCGAGATGCTTGCAAACTTTGAACACTTTTTTGAAATTAAGGAAGATGA CTACTCCCCGTTTTGCTTTGTCTCTTCTGATGCCGATCGTGAAATGGTTGAGGCAAGCACAAGCAATGAGGAGGACTCGG AAACATCGGGCGACTCCAATGATGCCGATGATGAGAGTGAAAATAATTCACTTGGGAGGGAAAAAACACGTTGTGGAAAT AAAGAAATGGATTCTGCCCAATTTTGGGATGAACATCCCCTTCTTGCCAGGGAGTTCTTGGAGAAACGTGGACTCAGCTT GCTAGATATCCATGACTTACTCGCAGGAAAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805866: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058663366523AI066358TENU2474T. cruzi epimastigote normalized cDNA Library


Date: 6:2:13 on Sun 19 Nov 117.