EST 1805870 is a singleton


Sequence

>1805870 (1 EST) Length=558 TAATCGTTACAGGCAGAGAGGGTTTTATTATATCTTCTTGCGAATGATTCCCATCCAGGGGGCAATGTCATGCTTCCCAC GATCGTCTTGTATGTTCTTGCAGTTGGTGGCTGTGGTCATAGTGTTGACTGTGCTCGATACGGCACAGGCTGTTCGTGTG CGCTCGACTGCCCAAGACCTTACGCTTGAGGTGAATCAGGAGGAGCTGTGCATGTACTCCGTGGGCATCGACACGAATGA AGGTGCGATGCTGCACTACCACGTGCTGCATGGGGGCGATGATTTTGATGTGAGCATCCGAGACCCGAAGAACAAGACGA TTTACGTGTCGTATGCGGGGGAACATGAGTTGGAGGACCGCGTCTACTTCACGAAACATTTGCATGGCGAGTACTCCTAC TGCATTGACAACCGCCCGTACTCTGGCAGCAGGAAATCCGTAACGATGAGCATCGGTGTGACTTCCCTGAAGCGATGGAA GGACCGCATTGATCCTCTTACAAGGATGATGCTGCGGACAGACAGTTTCATGTTGGGCCTTCATCAAGACCAGATCAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1805870: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18058703366527AI066362TENU2478T. cruzi epimastigote normalized cDNA Library


Date: 1:43:43 on Sat 18 Nov 117.