EST 1814583 is a singleton


Sequence

>1814583 (1 EST) Length=292 GCGCGCTCTTGCTAGACCTCACGACTAAGTTACTTATCGAAGATGTCTCGTTATTTGTTGTCAAGACAAGTGTTTAATAA GTTTTTAAATTTGAAGCCATTATGCTCTTCCTACTCATCTAGTCCTAAGGGACATGTTGTTGGCATAGATCTTGGAACAA CGAATTCATGTGTTGCAGTAATGGAGGGAAAGCAGCCTAAAGTTCTGGAAAATTCGGAAGGTTGTCGCACTACTCCATCG GTAGTGGCGTTCACGAGTGACGGAGACAGGCTTGTGGGTGCACTGGCANAAG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1814583: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18145833384943AI066976EST208641Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:13:22 on Sat 18 Nov 117.