EST 1814591 is a singleton


Sequence

>1814591 (1 EST) Length=271 GGTGCGGTTTCACTTTCTTACTCATCTGTTGCCATGTCTTCGTTTCGTGCTGCTGGACTGGTTTTACGTCAGTTGTCCAA TAAAAACCCATGTGTATTTAAACAACTTGGATGCCGATGGCTATCCACTTCATCTACCTTAAAAGCTGGAGCCCCAGAAT TCTCCAGTATTTTAGAGGAGCGTATTCTAGGACAAACATTGCAAACTAACTTGGATGAAACTGGGCGTGTTCTGAGCATC GGTGATGGGATCGCACGTGTCGATGGTCTGA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1814591: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18145913384951AI066984EST208649Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:59:16 on Tue 21 Nov 117.