EST 1814600 is a singleton


Sequence

>1814600 (1 EST) Length=400 GGCAAAGCAGATTGTTTCAAAATTTTCTATGTCCGATGACGGGTCCACAACCAATGGTGGCATAGCTGGTATGAAAAGGC CTGCTCAGGAGGAAAATAACAATTTTGCTACAACTGAAAAACGCCCTTTAGTAATGGATAAGGTAGCTGCTGCTGCAGAA GCTGCTGCTCGGATAAATCAGAAGTTGGGTGGTTCACAACCGACCTCAACGCTACCACCAACTTCAAACAACAACTCTGT TGGTTCCAAGGTTGTTACTACTGATACTGCTATCCCTGATAGATATGTTGGCCTAGTTATAGGGAAAGGTGGGGAGCAAA TAACACAACTTCAAAATGATACACAATGCAAGGTTCAAATTTCCCAAGCTGGTACTCCCGAGCGTACTGTTACCCTAACT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1814600: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146003384960AI066993EST208659Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 12:9:3 on Fri 17 Nov 117.