EST 1814636 is a singleton


Sequence

>1814636 (1 EST) Length=136 TTTGCCTCATGGTCTGTTGATAATTTACTCGTCCTTGTATGTTTGTTCGGACTGGCATTTGGTTACTTCTAAAGTAATTT CCTTGTAAATAAGCAGTAAACCTAAGAGGATAGTACATGACAATACAGGTTATGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1814636: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146363384996AI067029EST208698Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 19:19:50 on Sun 19 Nov 117.