EST 1814684 is a singleton


Sequence

>1814684 (1 EST) Length=282 GCACAGTAGTAAGAATATGATGTGAATTTTGACGGTAAACGATTATAAAACTAATTATTGTCAAAAAAACAATACCTCTT TCATTTGTTATACTTATCATTCTCTGTTAAAGGAAACACTTATTTTCTCCTATATATATTTGTTTTATTGATATCACCTT GAACATTCTTTTTTTCTTTGAAGAGTCCATTTCTTTTTTGTGATAGTTGTTTACTCACAGATTTTTTTATTTTCTTTCTA TCTTGTTATTTCTCTCCTATTTCCTGATTCTGCACATTTCCA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1814684: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146843385044AI067077EST208747Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 13:23:49 on Thu 23 Nov 117.