EST 1814686 is a singleton


Sequence

>1814686 (1 EST) Length=268 GTGGACTTATTGACATGGCTATGCCATTCTTAATTCAAACTTTGAGAGAGTTAACAACAAAAGTGGATCGTCTAGAACGC TCTGAACAAACTCGTGCTGCTGAAGAGGAGAAAGCTGAACAGGCAGTTAATCCGCTAGTGATGCGAACTGAACCTCAGTT AATGTTACCGGGACCAGCAGGATCTATGCCAGCAGCCTTAATCCCACCAACGGGCGCACCGATTGGAATGTTCGGAGTTA CTGGCCCACAAATGTATTATCAAACAAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1814686: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146863385046AI067079EST208749Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 7:2:37 on Tue 21 Nov 117.