EST 1814692 is a singleton


Sequence

>1814692 (1 EST) Length=132 AATGCGCATTGCTAAGATGAGTAGATATCATAAATAATACATTGTAAAAGACGCTTCCAATGTTATTTAAACAAATACTT AATGTTTCTTATTAAATAAAGAAAGCGATTTTTGTGGAATACATGGAGAAAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1814692: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18146923385052AI067085EST208755Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 3:46:55 on Sun 19 Nov 117.