EST 1814742 is a singleton


Sequence

>1814742 (1 EST) Length=504 TACCATAATCATCATCATGAATTGATTTATTCATCGTAAAAAGCTAATACACTTCATGTATGTATAAATCAGTGAATATA CAGACAGAATATGTAGAGTAATAAAAGTAATAAGGCGGACTAAGCACTAAATAACAATGATAAAATTATACTTGATCAGA TACCTTTTCTCGCAATTCACATCAACGAGAAAATCAATGGTGAAAAATAAATGAATAACTGATTGAAAAATAAACTTTCT AAACAGAAAAAAAATCGTGACGGTAATAGCAGTAATACTATATTATTAATAGTAGCAGATAGACAATTTTCTCTAAAAAA ATAAATTAAGTAAAGAAAAAAAGCGATAACAAATGCGAAATTATAGTTTGGTCTTTAAAAAAAGAAAAAAAAACTGGAGA TTCTCTTCAGACCAGATTAAAACAGCCTGATTATAATTGGGTTGATGTTAAATATCTTTCTCATTGTTTTATATTTCTTC TCCAGCTACCACGATATTACACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1814742: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147423385102AI067135EST208806Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:51:30 on Fri 17 Nov 117.