EST 1814789 is a singleton


Sequence

>1814789 (1 EST) Length=630 GAATGCAGCTGCATGGCATGTTTTTTTTTTTTTTTTTTTTTTTTTTGAAATATATCTGATTGTTATTTGGAAGTACTGTA CATTATAAATGAACAACAGAAGCTTATATTACTAAAGATAACTGAAAAAAATTCTACCGTTCCTGTCTTGCTTCTGACAA TTTGCAAATATCATCCAAAGAAACGTTCTTGACAAGACGACCCATACACAGACCGGTCATCACTGTTATTTCACATATAT TCTTTTCTTTAAAAACTTGCTCTAACGTAGCGTACTCTCCTCGGTATGCGCCATTAACGATGAGAACTGTTGATGATGGT TCAGGAATAACTGTTTGAACGTGATTTTGATCCACTTTGATCTTTGTGTGACATTCCACTGTCCTTACGATAGCCGTGTA ATTATCCAGCATCTTCAAAACTGTGGCATGTCTCCAACGTAGATCATCAGGAAGTTTGCGATTGATTAGCTTGACTTCAA TCCCTTCTGTCATCCAGTAATCTCTTCGGTTTCTCTTGTCTTTAAAAGCTTCTTCTTTTTCCATTAATTCATCCAAGGCA CGCCGACGAACTCCAGAAGCTGCTGTAGTACGTGTGTCTTGGTTCTTTTCGGCACTAGATTTGGATTTTT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1814789: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147893385149AI067182EST208854Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 23:18:29 on Fri 17 Nov 117.