EST 1814797 is a singleton


Sequence

>1814797 (1 EST) Length=564 TCCAGCTTAGATCCATGGTTAAATGTTAAAGCTAAGGCTGAATTAGCCGGCGCTATGGTTGTTTTACAACAGGCTCGTGG ACAAGTAACTGGATTCTTAGCCAGTCTTATATTATGTGAAGTCAAAAAACAAAGTGATCCAAATATGGTTTTACGTGCTA ATAGTATAGCAACTAAAGCAACAGAAATTTATCTACGTCTTGTTGGTGGTTCATATTTATCAAATATTTTATCTGATTTT GTTCAAATTGTTATTAGTGGCCGACCAGTTGATCCACAATTAAAAACATCTAATCGTTATCCAATTGATTATGAAGTTGA TATAGCTAAAGTGCAAACATCTGCACAATTAGCACAAAATCAAGTTAATCTATTAGGTTTAGTTGAAACTGTATGGAAAC GAATTCTATCAAGTGAAGTTGAATTTCCAGAGCAATTTAGAGCGTTATTTGTAGAGATTAGACGTTATCTAGAGAATGGT TTAAAAAGTAATTATTCATCAATGAATAATATTCATAATANACATTATGATGGATTAAATTCTTCAAATTCTACAATGAA TGAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1814797: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18147973385157AI067190EST208864Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 2:55:49 on Mon 20 Nov 117.