EST 1814823 is a singleton


Sequence

>1814823 (1 EST) Length=233 AAATTATAAAAATTAATAACCAATTAGTGAAGAATTGTTTCACTTTTTTGTTGAAATTTATTGACATAACAATATTGTCT AAATGAACATATGAAAATACTATACCATCTTTTATCCTTTCCCATTGCATATCATTATGTGGTTGTTCATTGTTATCTTC TTTATGATCATTATCATCATTGTATGGAATTAAGAAAAGAATAATAATAAATATTCTATCACATAACTACTGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1814823: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148233385183AI067216EST208890Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 4:23:0 on Thu 23 Nov 117.