EST 1814827 is a singleton


Sequence

>1814827 (1 EST) Length=590 GCACGAGCTGGGTCTGCTTTGTCCCACCCCCCTGGACTCCCAGTTAATGAAAGTAGAGGTCGCTTGGATCTTAATCCTAG TCGTGTTTCGACTGGATGCTCTGAATTGTCTCCCATACCAGCATCTCAGTCTGTTTCACTTGATAATCTAAATCAGAATA ACTACCCGAACAATTCATACCAGATGCCTGCAGTCGGTTGTCGACCAGCTCCTATAGGGACCGTTCATGCTGATACCCCC CAGGTTTCTGATACTCATGGCCCAAGGCCATTTGGAGATATGCGTAGCGACATAGATCCAGGGATTTTCAGCACATCTGG AAGAGGAGGTATAAGTTCTAGAGATGTTCAAGAGTCTGGACTAGGTCCTACTAGACATCGTGCTGTCCTAGGATCTGGTG TGCATAATGACTACCCGCAACCATGGGTTAACCGAGATCAAGGAGTTAGAAAGGGTGACACTCACAAAAATACACCCAAT TATTATCAGGGGCATGATTACTCAATGGATAGACGCGGAGGATATAGTCAACAATGGTCAACAAACCATCGTGGCTCCAG GGGTTCTGGGCATACTTACGGTGGTTGGGG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1814827: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148273385187AI067220EST208894Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 19:10:5 on Sun 19 Nov 117.