EST 1814835 is a singleton


Sequence

>1814835 (1 EST) Length=499 CAAATACAGACATTTACTTTTCATGAAGTGTTGACCAGAAAAAAATTCATTATTAGAAAATACCATAAGTGAAATGAATG TTGAAAAAAAAGCAATTTAATTCATCCCAACATAAAATACTTATATGTTGTAAAACAGAACAAGCCAAAATATGAAGGAT ACTTTAGGTAGAAGGTAATCAATTATGCAGAATTTTAATGCATGATTATGAAATGCGATAAATGCCATATATATATATAT ATATATATATATATATATATATATATATATATATATATATTGAGATCAGAAGCAATTTGCAAAATAAAACAATGGGAAGG CAACCCAAATTGGTTCACAGAAATATTTGAGTCGGAAGTGACCTACGGAATGTGAACAACAGAATTTCAATATGCTTCGA ACGGTGGCTGTTTGAAGTTACTCAATGAGTATAGAAGATACGGTAATACAGCCACTTAGAAAGCCACAGAGAAAATGAAT TGTCGAATTTGAACACATA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1814835: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148353385195AI067228EST208902Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 9:34:37 on Fri 24 Nov 117.