EST 1814856 is a singleton


Sequence

>1814856 (1 EST) Length=429 GAAAATAAGTGACCATTTGCATATGATCCACGTTCCTGTGAACTTGAGATATCAATACGATTGAGTTTCCGATTTTCGAA GCACTCTGGCTCAAGACTATTTAACTTACGTACAGTTTTAGGCTTATGGGATTTTTTTCCAGGTGATTCAGTGCCCTTAT TAAAAGAAGTTGATCGTCCATAACTATCCAAATCAGTATCTGTAGTAGTTGAACAAGCATCTACAGGTAAGGGTAGTATA TCTGTTGACTCATTGGACTGCAGTAAACGTCGTCTTTTGGATTTACGTTTATGAATATTGGGTATATCAGGCTTATAGGA AGGCACAGAGGCATCATTACAGTTTTCATCCAAAGCACTGGCATGAGGAAGTGAGAGTTGTTTCGCATCTGACGAAGAAA CTAAGCTTGGTGACGGGTTAGCATCACAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1814856: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148563385216AI067249EST208923Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:55:44 on Mon 20 Nov 117.