EST 1814872 is a singleton


Sequence

>1814872 (1 EST) Length=449 AAATATTAGATGAGAATGATAATGCTCCTGTCTTTACTAATCCTCCAGTAAGATCGTCTGAAGCACCTCAAGGCGACAAT GAAAAATTTGCATTCACAATTATGGAAAATGCTCCACGTTTCACACAGTTAAGTCAACGATTAGAAGCCAAAGATCCGGA TCAAGGTGATAATGGAAGAGTTCAGTTTTCTTTGCTAGCTACATATGCTCTTACGAAGTCATCAAGGCGAAATCAATTTA TTGGTTCTTCACCAAATATGTTGACTAGTTTTGAACATTTCATTGATAGACCAGGATCAGATCCCAATAGTGAAGCCGGA ATGACACGTCACGTGGTTGACCAGCCTATAGTCCGAATTACGTCAAATGGAGTAATTGACACACTAGTTGAACTAGATAG AGAAACAGTGCCTGTATATACACTTAAAATTGGAGTTCGCGATCGTGGT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr,


Cluster Information for 1814872: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18148723385232AI067265EST208940Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 4:35:11 on Wed 22 Nov 117.