EST 1814928 is a singleton


Sequence

>1814928 (1 EST) Length=416 GCACGAGAGTCGGATTCACAGAAACATAGTGTTGAATTAAGTTAAGGGATGTAACAGTACAAAATACACTCGGAAATGCT AGTCTAAGATTTTTAAAGGTGTTAATACTATCCGACACTTCAGTTTATTTTTTCTTTAAAATATCCAGACCAGCGTCGAA CTTAGGATCAGCAACATTGAGGATTAAAGAACCAGAATGTAAAAATGCACGATTTTGAGACTGAGCAACCGTTCGAGCAA TCTGAGTAGCCGCTTTTATTTTCCGAAGCTTAAGATATCCAGGGTTCTGAGAAAGGGCATCACCAATCAGTTTGGCAGCT TGAGCCTCACCTTCAGCAGTAACTATCTTTTGCTGACGTTCTTGTTTCGCACGTTCTACGAGGAACTGAGCACGCTGTGC TTCTTGTAAAGCAATC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1814928: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18149283385288AI067321EST208999Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 0:50:1 on Fri 24 Nov 117.