EST 1814981 is a singleton


Sequence

>1814981 (1 EST) Length=169 GCCAAGTTTCGCTGAGAGGTTATGGAAGCTTGTACAGCAATTAAGATGAGAAAACGTCCATTTGAGTTCACAACTGAATG ACCAAGACTTTCCTGCCCTTCCAAAAGCGGGGTTATCTCCACCTGTCAAAGTCATATGTGCTTCAACACCTTCATAACAA GCTAAGACC


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1814981: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18149813385341AI067374EST209054Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:3:5 on Thu 23 Nov 117.