EST 1815029 is a singleton


Sequence

>1815029 (1 EST) Length=498 GCACGAGGTTAAAGGGCGTAAAACTGAACGTGAAAAATTCGCCGGTGCAGATTATACGACAACTGTGGAAATTTATATTG ATGGGAATGGACGTGCAATTCAAGGTGCTACATCACATCATTTAGGTCAGAACTTTAGTCGTATGTTTGATGTGACATAT GATCATCCAGTGACTGGTAAACCTGCCTACGTCTATCAAAATTCTTGGGGTCTTACCACTCGTACACTAGGTGTTTTAAT TATGGTACATAGTGATGACAAAGGTCTTGTATTACCACCGAGAGTTGCACCATATCAGATTGTTATTGTTCCTTGTGGTA TTACTGCAAAAACAACTGTACAAGAGCGAGAAACTCTCTTGTCCGCTGCTCATTCTGTATTCGAATTATTAAATAAGTCT AATAAACAATTTCGTGTACACTGTGATGATCGTGATAATGTATCACCTGGATGGAAATTTAATCATTGGGAATTAANAGG NGTCCTATTCGCTTAGAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, dbEST,


Cluster Information for 1815029: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18150293385389AI067422EST209104Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:3:18 on Thu 23 Nov 117.