EST 1815031 is a singleton


Sequence

>1815031 (1 EST) Length=514 CATTGGTCTAGTTAGCAAAATTATCGATTTGAAAGATAATCTCTCTGATTCTCAATCATTTCACGATTTCACTGTATCTG AAGAGAAATACAAATCCAATAAATCGAATACTTTACAAATTAATCCTTCAAATATTAAAACTTATCAAGAAACAACAATG AAACATATTTCATTACCAATTAAAACTAGCACATTAGGAATTGGTGATTCGTCTATGACAAAAAAGAGTACATCAAAGAA AAACACTCAAATATCAAATAGTCTCTTGACGAATTACAATCAAATTGTAAATAAAGATGATACAGATTTATTATTTGACG ATATCAAATTTAATGTGATGTCTGAATCAAATGAGTTAGATTTAGGCTCATCATTACTAGATGAAGTATTCANATGTTTC NCAATCGAAAAATCTACTACTAATGACAATATGAATCATAATACTGATGGTGATAAAAAGTCAAATGGTGTTATTATTAC TACTACTGGCATTACTACTAATGATGAGGATATT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815031: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18150313385391AI067424EST209106Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 14:33:33 on Fri 17 Nov 117.