EST 1815048 is a singleton


Sequence

>1815048 (1 EST) Length=464 GCTATTATTGAAACTCAATGGGAAACTTGGTGGTGTTAATTGGATTGTCCCAGATCTTACTGAGTACAGCAAGGATTTAA TAATGGTTTTCGGTGCTGATGTTACTCACCCAGCACCGACACAAACTCATCAGGTTCTCAAGTCAGTTGCTGCCGTTGTT GGATCTGTCAGTCCTGAGTTAATGCGATACGGGGCTATAGTTAGACAACAAGCGACTACTGAACGAGGAAACAAAACAAC GAGAGAAATTATTGATAACTTGCATCTGTCAGTTGGAGAACTGCTCACGCTGTACTTGCGGAATACGAATGGACGTTTTC CTAAACGTATTATATTCTATCGCGACGGTGTCTCAGAGGGTCAGTTTGAAAATGTCTTGGTCGANGAGTTATCTGCGATT CAAAAAGCTTGCAGTGACATTCGTCCTGGTGAAGAACTGCTAGTACATTTATCGTTGTCCATAA


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, gbnr, Processing,


Cluster Information for 1815048: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18150483385408AI067441EST209123Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 6:4:26 on Sun 19 Nov 117.