EST 1815065 is a singleton


Sequence

>1815065 (1 EST) Length=264 AAAATATATAAAAGAGGGCACTTTTAACTGAGAAGGATACAATTTAAAAACTTTTTTAAGTTATTCATACAGAGAGAGTT AGGTAATAGAGATTTTCCAACTACGAAAATGCTATAAAACATATTTAGAATGTAATCTAAATCAGTTTTATGGCATGTAT CCAAAAAAAATATAGGGAAACGAATAAGGAAAGTTGGATTTGACTGTTTGGCAACTTTGCAGCATAGTTATTATTCCTCT CTCATCTTTGTGCGTGAATCATAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815065: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18150653385425AI067458EST209140Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 16:58:2 on Wed 22 Nov 117.