EST 1815077 is a singleton


Sequence

>1815077 (1 EST) Length=409 GGAGAACTAGTCTCGAGTTTTTTTTTTTTTTTTTTATATCAAAATTAATTTATTAACATGAATAAATAAATGAAATGAAA ATAATCATAGTTTTTCAAAGATCTTTTTTTTCATAGGTTAATGCAGAAATATGTACAGATTGAATATATTCAAAGAGAAA GAATTAAAGAAAAAGGAAAGAAGGAAGATTCATTGTGAAACATTGTGAGGTAACTGTTGAATAAGATAATCAAATAAAGA TAAAATGGCTCTTTTAGATTGTTCTTCTGGTATTGATATATTTCGAAAATTGAAACAAGTACCATGATTAGTATTATTAT TACTTGAAAGTTTTAAATGTTCAGATCTATAATGAAAATAGTTGAAGATGGCATTGAATAAATCTTTAGGAGTCCATGAA GCTTTGTAT


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence,


Cluster Information for 1815077: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18150773385437AI067470EST209152Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 15:0:40 on Sun 19 Nov 117.