EST 1815102 is a singleton


Sequence

>1815102 (1 EST) Length=293 CGAAAAGAATGAGCTTACACAATGAAATTTAATAGGATTAAACTTATGTAAACAGTATATGTTTAGCATGTATTGATATT GTCTCTCTCTCTCTTTCTCTCTATGTATATATAAATCATGTATCTAAGGGGAATCTTTGATCTTCATAATGTAATATTCA ATTGATATTTATGATTTACCACTCCCTGAAAATTTCTGTCTTAAAGCCATAATTGCTGGTGAAATATTAGATACTGAATT TGATCGTTTAACTATGGATTGTGAAGAATTTTCATGATGATTTATTGATGATG


Analyses

Predicted Translation
Prosite Motif Search WITH / WITHOUT phosphorylation sites
Sequence, dbEST,


Cluster Information for 1815102: (1 ESTs)

dbEST ID numbers are linked to dbEST, and gi numbers are linked to Entrez.

dbEST IDgi NumberAccessionEST IDLibrary
18151023385462AI067495EST209177Schistosoma mansoni, Phil LoVerde/Joe Merrick


Date: 7:22:27 on Mon 20 Nov 117.